View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257-Insertion-10 (Length: 111)
Name: NF5257-Insertion-10
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 3e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 3e-45
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 22085654 - 22085756
Alignment:
| Q |
8 |
tctttattcctgtcaaatctcccaaagctctagaaggttcatggtgcacagaaggtcttctcaggacacacataaaccttctttcgaatttgatctttgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22085654 |
tctttattcctgtcaaatctcccaaagctctagaaggttcatggtgcacacaa-gtcttctcaggacacacataaaccttctttcgaatttgatctttgt |
22085752 |
T |
|
| Q |
108 |
ttgc |
111 |
Q |
| |
|
|||| |
|
|
| T |
22085753 |
ttgc |
22085756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University