View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257-Insertion-3 (Length: 385)
Name: NF5257-Insertion-3
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257-Insertion-3 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 177 - 385
Target Start/End: Original strand, 6802663 - 6802872
Alignment:
| Q |
177 |
aaactttatcatattaattagatctagaagagcagcatcacactgcttgcaaagtaactgcatatattatacaagcacatacatgcacatagaacattta |
276 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6802663 |
aaactttatcatattaagtagatctagaagagcagcatcacactgcttgcaaagtaactacatatattatacaagcacatacatgcacatagaacattta |
6802762 |
T |
|
| Q |
277 |
ttgtagtcgtggtggatatataga-nnnnnnnnnnnggtagtgtggatggatatatagaatattttattgatattatcaagtgacttataatttacgata |
375 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
6802763 |
ttgtagtcgtggtggatatgtagattttttttttttggtagtgtggatggatatatagaatattttattgatattataaagtgacttataatttataaca |
6802862 |
T |
|
| Q |
376 |
aaatcttttt |
385 |
Q |
| |
|
|||||||||| |
|
|
| T |
6802863 |
aaatcttttt |
6802872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University