View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257-Insertion-6 (Length: 250)
Name: NF5257-Insertion-6
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257-Insertion-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 5214332 - 5214575
Alignment:
| Q |
7 |
aatccgttgaaataatttccaacgggctataattgtttttggtacttggcatgttggagctagatgttgattggcattttctcatcaatgaggtgtcaaa |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5214332 |
aatccgttgaaataattttcaacgggctataattgtttttggtacttggcatgttggagctagatgttgattggcattttcttatcaatgaggtgtcaaa |
5214431 |
T |
|
| Q |
107 |
atctatgattggattttacctaaccaataatgtcatttttgtctaacttcaaattgataattagccaaaaaattattcacatggacatgtttcattgcta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5214432 |
atctatgattggattttacctaaccaataatgtcatttttgtctagcttcaaattgataattagccaaaaaattattcacatggacatgtttcattacta |
5214531 |
T |
|
| Q |
207 |
gcatcacaggcgataaatatttgcttccccgacctcggtagcgt |
250 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
5214532 |
gcatcacaggcgataattatttgcttccccgaccttggtagcgt |
5214575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University