View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257-Insertion-7 (Length: 210)
Name: NF5257-Insertion-7
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257-Insertion-7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 8 - 117
Target Start/End: Original strand, 4175356 - 4175465
Alignment:
| Q |
8 |
ctctccactgcacgcaactcttggctgcacaatagcccatacatttcataaatatttattgtaacaatgacaaaaaccaataatgataaatatctaaaat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175356 |
ctctccactgcacgcaactcttggctgcacaatagcccatacatttcataaatatttgttgtaacaatgacaaaaaccaataatgataaatatctaaaat |
4175455 |
T |
|
| Q |
108 |
aagatactac |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
4175456 |
aagatactac |
4175465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 204
Target Start/End: Original strand, 4175751 - 4175821
Alignment:
| Q |
135 |
ttctatgaaattcataagcaatgtatgttgttagggactattctattgtt-caaagagagtgccgataaca |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
4175751 |
ttctttgaaattcataagcaatgtatgttgttagggactattctattgttagaaagagagtgtcgataaca |
4175821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 4171366 - 4171423
Alignment:
| Q |
8 |
ctctccactgcacgcaactcttggctgcacaatagccc--atacatttcataaatatt |
63 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||| || ||||||||||||||| |
|
|
| T |
4171366 |
ctctccactgcacgcacctcttggctgcacaataccccttatgcatttcataaatatt |
4171423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University