View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257-Insertion-9 (Length: 117)
Name: NF5257-Insertion-9
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 4e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 49438937 - 49438832
Alignment:
| Q |
10 |
aacattgaatactcaatatgcccttgatagctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacctcaaggttgga |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49438937 |
aacattgaatactcaatatgcccttgatagctttaacgagtttgtgtactccattctgctcaagctagattccatcaagagttttcacctcaaggttgga |
49438838 |
T |
|
| Q |
110 |
tatggt |
115 |
Q |
| |
|
|||||| |
|
|
| T |
49438837 |
tatggt |
49438832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 39 - 112
Target Start/End: Complemental strand, 49435065 - 49434992
Alignment:
| Q |
39 |
gctttaacgagtttgtgcactccattctgctcaagctagattccatcaagagttttcacctcaaggttggatat |
112 |
Q |
| |
|
|||| |||||||||||| |||| || || ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49435065 |
gcttcaacgagtttgtgtactctgttttgttcaagctagattccatcaagagtttctggctcaaggttggatat |
49434992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University