View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257_high_25 (Length: 211)
Name: NF5257_high_25
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257_high_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 32001919 - 32002111
Alignment:
| Q |
1 |
taccatatatggtaatgaagagccaataaactttactgcataggtaaatttgaggtatccccgttatgtttaattgcaaccctcttcttctttttcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32001919 |
taccatatatggtaatgaagagccaataaactttactgcataggtaaatttgaggtatccccgttatgtttaattgcaaccctcttcttctttttcttct |
32002018 |
T |
|
| Q |
101 |
tgtaaggaattcctctagccttagcttgagaatctctcacttcacgaagatagattcttatggaaccactagcaaaaggattagattcaggta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32002019 |
tgtaaggaattcctctagccttagcttgagaatctctcacctcacgaagatagattcttatggaaccactagcaaaaggattagtttcaggta |
32002111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 129
Target Start/End: Complemental strand, 39556753 - 39556710
Alignment:
| Q |
86 |
tcttctttttcttcttgtaaggaattcctctagccttagcttga |
129 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
39556753 |
tcttctttttcttcttgtaagggatacccctagccttagcttga |
39556710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 88 - 184
Target Start/End: Complemental strand, 30942240 - 30942144
Alignment:
| Q |
88 |
ttctttttcttcttgtaaggaattcctctagccttagcttgagaatctctcacttcacgaagatagattcttatggaaccactagcaaaaggattag |
184 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||| ||||| | || | ||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
30942240 |
ttctttttcttcttataaggtatacctctagccttagcttgagactctctaatctccctaaggtagacacgaatggaaccactagcaaaaggattag |
30942144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University