View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257_low_21 (Length: 251)
Name: NF5257_low_21
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 25 - 232
Target Start/End: Complemental strand, 35118 - 34909
Alignment:
| Q |
25 |
ttaatcattttcgttctcagaatgttatttttat--gtgttatttgggggaggtaaggtaaggtgaaattagggtttcgttgttgtatttggggaagnnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35118 |
ttaatcattttcgttctcagaatgttatttttatttgtgttatttgggggaggtaaggtaaggtgaaattagggtttcgttgttgtatttggggaagaaa |
35019 |
T |
 |
| Q |
123 |
nnnnnnnctaaaccctaattttacaaatggtgtgtgcaggctgtgagatggatttgtgcgaatctcctccaaaggctaaggaaaaagattgtgttgttcc |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35018 |
aaaaaaactaaaccctaattttacaaatggtgtgtgcaggctgtgagatggatttgtgcgaatctcctccgaaggctaaggaaaaagattgtgttgttcc |
34919 |
T |
 |
| Q |
223 |
tgtaactcct |
232 |
Q |
| |
|
|||||||||| |
|
|
| T |
34918 |
tgtaactcct |
34909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University