View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5257_low_29 (Length: 207)
Name: NF5257_low_29
Description: NF5257
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5257_low_29 |
 |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0027 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 191
Target Start/End: Original strand, 123252 - 123426
Alignment:
| Q |
17 |
aaaatgaccactagcaacttcaactctatgccaccctcctctttgttcttccttctcaacacttttctcacaaatgatacatagaactctatcctcatca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123252 |
aaaatgaccactagcaacttcaactctatgccaccctcctctttgttcttccttctcaacacttttctcacaaatgatacatagaactctatcctcatca |
123351 |
T |
 |
| Q |
117 |
acttcaactcgaacatcgcttcgtttcagccccggaaggtgtgctttgtagatatgagcttcatgggtttctttc |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
123352 |
acttcaactcgaacatcgcttcgtttcagccccggaaggtgtgctttgtagatatgagcttcatgggtttctttc |
123426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University