View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_high_38 (Length: 292)
Name: NF5258_high_38
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_high_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 9 - 292
Target Start/End: Complemental strand, 32539581 - 32539298
Alignment:
| Q |
9 |
agcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
108 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539581 |
agcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
32539482 |
T |
 |
| Q |
109 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatcttcacaagaatctcactctcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32539481 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatcttcacaagaatctcactctcat |
32539382 |
T |
 |
| Q |
209 |
tatcatatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtctt |
292 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539381 |
tatcacatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtctt |
32539298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University