View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5258_high_56 (Length: 237)

Name: NF5258_high_56
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5258_high_56
NF5258_high_56
[»] chr4 (1 HSPs)
chr4 (8-108)||(24888157-24888257)
[»] chr5 (1 HSPs)
chr5 (24-110)||(13520447-13520536)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 24888257 - 24888157
Alignment:
8 catggatttttgtcgatgttgttgttgagatccgagagagaagagggggatgagttttctttatgatgttgttgttaccgttttgaatgagaaggaggaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||    
24888257 catggatttttgtcgatgttgttgttgagatccgagagagaagagggagatgagttttctttatgatgttgttgttactgttttgaatgagaaggaggaa 24888158  T
108 a 108  Q
    |    
24888157 a 24888157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 110
Target Start/End: Original strand, 13520447 - 13520536
Alignment:
24 tgttgttgttgagatccgagagagaagagggggatgagttttctttatgatgtt---gttgttaccgttttgaatgagaaggaggaaaca 110  Q
    ||||||||||| |||| |||||||||||||| ||   |||||||||||| ||||   ||||||||   ||||||||| ||||||||||||    
13520447 tgttgttgttgggatcggagagagaagagggagagaggttttctttatgttgttgttgttgttacttatttgaatgaaaaggaggaaaca 13520536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University