View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_high_60 (Length: 229)
Name: NF5258_high_60
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_high_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 20 - 113
Target Start/End: Original strand, 29478063 - 29478156
Alignment:
| Q |
20 |
ttccaagccaacatccatctaccatcaactcatagttagatatgttgaaaaatataatataactgaaatggaaatggaaatgttaagcctccca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29478063 |
ttccaagccaacatccatctaccatcaactcatagttagatatgttgaaaaatataatataactgaaatggaaatggaaatgttaagcctccca |
29478156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 217
Target Start/End: Original strand, 29478219 - 29478260
Alignment:
| Q |
176 |
ctacatagaagaatagaatttatagctttatatttcatctca |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29478219 |
ctacataaaagaatagaatttatagctttatatttcatctca |
29478260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University