View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_32 (Length: 358)
Name: NF5258_low_32
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 18 - 341
Target Start/End: Original strand, 41511524 - 41511847
Alignment:
| Q |
18 |
atatacctatcttttttcattctcctaaatttgccctaaaacattttcatcagccgcaacgcaacaccatgttttctcatctcatctctaccaaacactc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41511524 |
atatacctatcttttttcattctcctaaatttgccctaaaacattttcatcagccgcaacgcaacaccatgttttctcatctcatctctaccaaacactc |
41511623 |
T |
 |
| Q |
118 |
ttcttcactttctctactaaacacaaacgcctctaggttttctcttctattcaattgactttcattcttcttacgtggcggcggctcaatcacctaaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41511624 |
ttcttcactttctctactaaacacaaacgcctctaggttttctcttctattcaattgactttcattcttcttacgtggcggcggctcaatcacctaaatt |
41511723 |
T |
 |
| Q |
218 |
catgggatctgagggtcttggtagaccctcacactctaattcaattcacttctctaactcctcttctctaatccaaaatggttcgttacttcttatcttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41511724 |
catgggatctgagggtcttggtagaccctcacactctaattcaattcacttctctaactcctcttctctaatccaaaatggttcgttacttcttatcttt |
41511823 |
T |
 |
| Q |
318 |
accccaatttcatttttctatgtt |
341 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41511824 |
accccaatttcatttttctatgtt |
41511847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University