View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_33 (Length: 357)
Name: NF5258_low_33
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 268; Significance: 1e-149; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 309
Target Start/End: Complemental strand, 29776790 - 29776495
Alignment:
| Q |
14 |
ttctcacttgcttgacaatgtccaaaacaattcaatattttgatctcaacaccggagccaaaatcccttccgttggcttgggaacttggcaagccgagga |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776790 |
ttctcacttgcttgacaatgtccaaggcaattcaattctttgatctcaacaccggagccaagatcccttccgttggcttgggaacttggcaagccgagga |
29776691 |
T |
 |
| Q |
114 |
cgatcctggcctcgttgctgaagccgtcgcttctgccatcaaggtaaattttcattatcattcatccttccacttgagttttggaaatctctttgtatat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776690 |
cgatcctggcctcgttgctgaagccgtcgctactgccatcaaggtaaattttcattatcattcatccttccacttgagttttggaaatctctttgtatat |
29776591 |
T |
 |
| Q |
214 |
aatataatgaataatgatattttcttttatacatacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggtagcta |
309 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29776590 |
aatataatgaataatgatattttctttgatacatacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggtagcta |
29776495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 247 - 305
Target Start/End: Complemental strand, 29786906 - 29786848
Alignment:
| Q |
247 |
tacaggccggttaccgtcacattgattgtgctcaattatatggcaatcagaaggaggta |
305 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29786906 |
tacaggctggttaccgtcacattgattgtgctcaagtctatggcaatgagaaggaggta |
29786848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 57 - 104
Target Start/End: Complemental strand, 29787095 - 29787048
Alignment:
| Q |
57 |
tctcaacaccggagccaaaatcccttccgttggcttgggaacttggca |
104 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
29787095 |
tctcaacaccggagccaagatcccttccgtcggcttgggtacttggca |
29787048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University