View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_35 (Length: 353)
Name: NF5258_low_35
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 258
Target Start/End: Original strand, 3909007 - 3909247
Alignment:
| Q |
18 |
aaaatcgtccacctccgcaacaattctttcaactaggtggtaatggatcaggaccaatgtttacctctcaaccacgaggtttgaatttgattcctccatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909007 |
aaaatcgtccacctccgcaacaattctttcaactaggtggtaatggatcaggaccaatgtttacctctcaaccacgaggtttgaatttgattcctccatc |
3909106 |
T |
 |
| Q |
118 |
tagcatggttaatgctactacttctgttgctactgtttctactgcttataatgaaaattggcctcaaaacttcatcaatagtggtaacaacagagcctct |
217 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3909107 |
taccatggttaatgctactacttctgttgctactgtttctactgcttataatgaaaattggcctcaaagcttcatcaatagtggtaacaacagagcctct |
3909206 |
T |
 |
| Q |
218 |
gatcaatctttatggagtactatcagcaccacttcaattaa |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3909207 |
gatcaatctttatggagtactatcagcaccacttcaattaa |
3909247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University