View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_38 (Length: 337)
Name: NF5258_low_38
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 20 - 300
Target Start/End: Original strand, 32704917 - 32705193
Alignment:
| Q |
20 |
gacccaagaatcaaaaggtacttctatagacatttattgattacttatatacaatcccttactaagcctcaacgacttactctataataagttttatgat |
119 |
Q |
| |
|
|||||||||||||||| |||||| | ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32704917 |
gacccaagaatcaaaaagtacttatgtagacatttattgattacttatatacaatcc-ttactaagcctcaacgacttgctctataataagttttatgat |
32705015 |
T |
|
| Q |
120 |
gatccaagccctcacaaaacaccaa-ggaaaaaagacgaagtttgtggctacgaaagcactctcaaactcaaatttgtgtttcctcctcatattttgtgg |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32705016 |
gatccaagccctcacaaaacaccaagggaaaaaagacaaagtttgtggctacgaaagcactctcaaattcaaatttgtgtttcctcctcatattttgtgg |
32705115 |
T |
|
| Q |
219 |
cagnnnnnnnnnnnnnnnnnnnnnataggcaaatgttggtaatgctagttttaggggattgaacctaagacatcctccttca |
300 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32705116 |
cag----ttttgaattttttttttataggcaaatgttggtaatgctagttttaggggatcgaacctaagacatcctccttca |
32705193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University