View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_44 (Length: 285)
Name: NF5258_low_44
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_44 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 41 - 277
Target Start/End: Original strand, 46772400 - 46772636
Alignment:
| Q |
41 |
atcgtatggttgattaaaaccggacaagaatgcacaaaacgaaaagtcttccactttgtgaccaaactacacatatgttttgttaatttttcaattatcg |
140 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
46772400 |
atcgtatggttgattaagaccagacaaaaatgcacaaaatgaaaagtcttccactttgtgaccaaactacacatatgttttgttaatttttcaattgttg |
46772499 |
T |
 |
| Q |
141 |
tatatatacgttgcatacatgcacgagannnnnnnnnnnnnnnnnnnnnnnnatataattcaaacaacttgcatgagatctttattactgggggcagaga |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
46772500 |
tatatatacgttgcatacatgcacgagatcttttttctttctttctttcttcatataattcaaacaacttgcatgagatctttattattgggggcagaga |
46772599 |
T |
 |
| Q |
241 |
tctaaaacaagtacaactttaaaaacagtggttaatc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46772600 |
tctaaaacaagtacaactttaaaaacagtggttaatc |
46772636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University