View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_45 (Length: 275)
Name: NF5258_low_45
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 103 - 259
Target Start/End: Complemental strand, 27449034 - 27448878
Alignment:
| Q |
103 |
tagaacaattgtgtaatttgaacaataactttttcgacaacaaatctaagttgttgactgatataccaactgcaaatcccgttaagcatcaatgctactt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
27449034 |
tagaacaattgtgtaatttgaacaataactttttcgacaacaaatctaagtggttgatggatataccaactgcaaatcacattaagcatcaatgctactt |
27448935 |
T |
 |
| Q |
203 |
gtttaactatgagtatcatgtttggtatctgtgtcagcgtttcatagatacaaatgc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27448934 |
gtttaactatgagtatcatgtttggtatctgtgtcagcgtttcatagatacaaatgc |
27448878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University