View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_46 (Length: 273)
Name: NF5258_low_46
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 34 - 258
Target Start/End: Complemental strand, 5933622 - 5933398
Alignment:
| Q |
34 |
acaccctcagtccaaagagaaaggaaagtgattcctattatcaaacaataaaaagtagaaaatgattcccagcttaaggggattgtaactatagagatca |
133 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5933622 |
acaccctcggtccaaaaagaaaggaaagtgattcctattatcaaacaataaaaagtagaaaatgattcccagcttaaggggattgtacctatagagatca |
5933523 |
T |
|
| Q |
134 |
ccttttaatagtagcttcatttcaattctcttttatatgatcaaatgatttccnnnnnnnnnacaataatgaaaatggtattttaatctatacaatctct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5933522 |
ccttttaatagtagcttcatttcaattctcttttatatgatcaaatgatttcctttttttttacaataatgaaaatggtattttaatctatacaatctct |
5933423 |
T |
|
| Q |
234 |
tctaataatccatataaatccaact |
258 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
5933422 |
tctaataattcatataaatccaact |
5933398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University