View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_48 (Length: 266)
Name: NF5258_low_48
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_48 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 52 - 266
Target Start/End: Original strand, 32539015 - 32539229
Alignment:
| Q |
52 |
gagataacattaacatcactccctttacctttacaaatctaccatgatnnnnnnntcattgattgcttcgaccagaagttagatgaggctatgatacaaa |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539015 |
gagataacattaacatcactccctttacctttacaaatctaccatgataaaaaaatcatcgattgcttcgaccagaagttagatgaggctatgatacaaa |
32539114 |
T |
 |
| Q |
152 |
aagggtctttttcatttgacttatttcaaacaaacaatgaaagggtttgtacttcagccgaggaaacatcgaattcgaagtcattggtttcaccggattc |
251 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32539115 |
aagggtctttttcatatgacttatttcaaactaacaatgaaagggtttgtacttcagccgaggaaacatcgaattcgaagtcattggtttcaccggattc |
32539214 |
T |
 |
| Q |
252 |
aagaagagaaggacc |
266 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32539215 |
aagaagagaaggacc |
32539229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University