View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_54 (Length: 252)
Name: NF5258_low_54
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 50511006 - 50510903
Alignment:
| Q |
136 |
tatttatttaattgaagaattcccaaattgattttcctcctcaaattgaatcagtccccgatccttcttcttcttcaaattgaatcatcacccttattcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50511006 |
tatttatttaattgaagaattcccaaattgattttcctcctcaaattaaatcagtccccgatccttcttcttcttcaaattgaatcatcacccttattcc |
50510907 |
T |
|
| Q |
236 |
gtcg |
239 |
Q |
| |
|
|||| |
|
|
| T |
50510906 |
gtcg |
50510903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 12 - 57
Target Start/End: Complemental strand, 50511130 - 50511085
Alignment:
| Q |
12 |
atgaatcctacatagcattgtctacttggtaatgctattaaacacc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||| ||||| |
|
|
| T |
50511130 |
atgaatcctacatagcattgtctacttgttactgctattagacacc |
50511085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University