View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_60 (Length: 237)
Name: NF5258_low_60
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 24888257 - 24888157
Alignment:
| Q |
8 |
catggatttttgtcgatgttgttgttgagatccgagagagaagagggggatgagttttctttatgatgttgttgttaccgttttgaatgagaaggaggaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24888257 |
catggatttttgtcgatgttgttgttgagatccgagagagaagagggagatgagttttctttatgatgttgttgttactgttttgaatgagaaggaggaa |
24888158 |
T |
 |
| Q |
108 |
a |
108 |
Q |
| |
|
| |
|
|
| T |
24888157 |
a |
24888157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 110
Target Start/End: Original strand, 13520447 - 13520536
Alignment:
| Q |
24 |
tgttgttgttgagatccgagagagaagagggggatgagttttctttatgatgtt---gttgttaccgttttgaatgagaaggaggaaaca |
110 |
Q |
| |
|
||||||||||| |||| |||||||||||||| || |||||||||||| |||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
13520447 |
tgttgttgttgggatcggagagagaagagggagagaggttttctttatgttgttgttgttgttacttatttgaatgaaaaggaggaaaca |
13520536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University