View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5258_low_9 (Length: 560)
Name: NF5258_low_9
Description: NF5258
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5258_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 542; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 542; E-Value: 0
Query Start/End: Original strand, 1 - 550
Target Start/End: Complemental strand, 48501409 - 48500860
Alignment:
| Q |
1 |
accttgttttcaccattcgtctcttttggttatgcgcttgcgacgcgcctagcgaagcaggttcactctatttccactcgttactcgctccggttctaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501409 |
accttgttttcaccattcgtctcttttggctatgtgcttgcgacgcgcctagcgaagcaggttcactctatttccactcgttactcgctccggttctaga |
48501310 |
T |
|
| Q |
101 |
aactgcgttgtcaaagaaactagcttcggtgctaagaaccttctttattaccgtaggtgtagacactgaactctgtttcatgcgcacccttgggtacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501309 |
aactgcgttgtcaaagaaactagcttcggtgctaagaaccttctttattaccgtaggtgtagacactgaactctgtttcatgcgcacccttgggtacata |
48501210 |
T |
|
| Q |
201 |
atagcaaaatggtgcattataagagaattgggtgtaggattacaaacactcgtgccatcgaatccgaaattctcttacgcgacggagtctcatggttttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501209 |
atagcaaaatggtgcattataagagaattgggtgtaggattacaaacactcgtgccatcgaatccgaaattctcttacgcgacggagtctcatggttttt |
48501110 |
T |
|
| Q |
301 |
ggattctgaaaggctacgcgccggttatgacgatgaaactggcgagaaactatgggcaaaatggtaaatttcaaggtattgatgctaaggagtcaataat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501109 |
ggattctgaaaggctacgcgccggttatgacgatgaaactggcgagaaactatgggcaaaatggtaaatttcaaggtattgatgctaaggagtcaataat |
48501010 |
T |
|
| Q |
401 |
caggtacggtctagctcaccaccaattggaagcacacgtgcagttggaatatacagttggattttatgatggattcattcgggttaatacacgtgttgat |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501009 |
caggtacggtctagctcaccaccaattggaagcacacgtgcagttggaatatacagttggattttatgatggattcattcgggttaatacacgtgttgat |
48500910 |
T |
|
| Q |
501 |
aatatgcgtctccatgtggcgaggttaggttttaaacacggtgatgatgt |
550 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48500909 |
aatatgcgtctccatgtggcgaggttaggttttaaacacggtgatgatgt |
48500860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University