View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5259-Insertion-5 (Length: 221)

Name: NF5259-Insertion-5
Description: NF5259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5259-Insertion-5
NF5259-Insertion-5
[»] chr1 (1 HSPs)
chr1 (8-221)||(40430042-40430255)


Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 221
Target Start/End: Complemental strand, 40430255 - 40430042
Alignment:
8 tgtttccggtggattcggtgtggcggcgatcacggtgttagcctggatttacaggtatgttacaggtaaacatccacctggagctgatcaactggacaca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40430255 tgtttccggtggattcggtgtggcggcgatcacggtgttagcctggatttacaggtatgttacaggtaaacatccacctggagctgatcaactggacaca 40430156  T
108 gcacgtcataagttgatgaacaaagcgcgtgagattaaggactatggtcagcaacaaatcagtgggacgcagaattcctaagcctgcacttgcatgcact 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
40430155 gcacgtcataagttgatgaacaaagcgcgtgagattaaggactatggtcagcaacaaatcagcgggacgcagaattcctaagcctgcacttgcatgcact 40430056  T
208 agattctacctcaa 221  Q
    ||||||||||||||    
40430055 agattctacctcaa 40430042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University