View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5259-Insertion-8 (Length: 128)
Name: NF5259-Insertion-8
Description: NF5259
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5259-Insertion-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 7e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 7e-47
Query Start/End: Original strand, 26 - 128
Target Start/End: Original strand, 5079757 - 5079858
Alignment:
| Q |
26 |
tgttgaaggccccctctatcaatttgtttgatactgtgaagaggtgcttttgtctttgttattgtttctttcattccacactaatgcaatttgtattaaa |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5079757 |
tgttgaaggccccctctatcaatttgtttgatact-tgaagaggtgcttttgtctttgttattgtttctttcattccacactaatgcaatttgtattaaa |
5079855 |
T |
 |
| Q |
126 |
acc |
128 |
Q |
| |
|
||| |
|
|
| T |
5079856 |
acc |
5079858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University