View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5260_high_12 (Length: 245)
Name: NF5260_high_12
Description: NF5260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5260_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 235
Target Start/End: Complemental strand, 44013885 - 44013667
Alignment:
| Q |
18 |
aaattattacggttttactttcgtgtctgttaggtgtttgtgttagtgtttcatagtgtctcagnnnnnnnnnnnn-atataatcatgcatacttatatt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44013885 |
aaattattacggttttactgtcgtgtctgtcaggtgtttgtgttagtgtttcatagtgtctcagttttattttttttatataatcatgcatacttatatt |
44013786 |
T |
 |
| Q |
117 |
tacataatttattgatgtttcagttttgtctcttattattttannnnnnngactgaattttgtctcttgttaaattgcagggaattagctatgcaaagct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44013785 |
tacataatttattgatgtttcagttttgtctcttattattttatttttttgactgaattttgtctcttgttaaattgcagggaattagctatgcaaagct |
44013686 |
T |
 |
| Q |
217 |
tgcaaacttgcctcatatt |
235 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
44013685 |
tgcaaacttgcctcctatt |
44013667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University