View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5260_high_13 (Length: 239)
Name: NF5260_high_13
Description: NF5260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5260_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 44014341 - 44014155
Alignment:
| Q |
18 |
actctcacccttcttcgttctgatgtcatttctggtctcaccattgccagccttgccattcctcaggtataacacacactaacttcttacatatgtctct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014341 |
actctcacccttcttcgttctgatgtcatttctggtctcaccattgccagccttgccattcctcaggtataacacacactaacttcttacatatgtctcc |
44014242 |
T |
 |
| Q |
118 |
gatatacttgatattgaagacttgtttggtgtcgagacatactatatttaattatttcattttgtgaaattaagacgtatctaatgtcca |
207 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
44014241 |
gatatacttgatattgaagacgtgt---gtgtcgagacatactatatttaattatttcattttgtgaaattaagacatatctgatgtcca |
44014155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University