View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5260_high_9 (Length: 305)
Name: NF5260_high_9
Description: NF5260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5260_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 30736492 - 30736772
Alignment:
| Q |
1 |
aaagcaacaacattggcaatggtgatgatgaatatagtgagttcgtcgtgacaaggatggtcttcaggatgaagacaattaaggttgttcaaggctgttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30736492 |
aaagcaacaacattggcaatggtgatgatgaatatagtgagtt-gtcgtgacaaggatggtcttcaggatgaagacaattaaggttgttcaaggctgttc |
30736590 |
T |
|
| Q |
101 |
tctctgaatattttgactttaattattttttaatttgaaagaatccatgaaaataggatagaaaatagtgtaccgtgcaattcatcggccttttctctcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30736591 |
tctctgaatattttgactttaattattttttaatttgaaagaatccatgaaaataggatagaaaatagtgtaccgtgcaattcatcggccttttctct-- |
30736688 |
T |
|
| Q |
201 |
taccatatagcactactgttatgatatagatagattagacaaagttacctcgtggttctcgtaacaccataaagttatagtattttt |
287 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30736689 |
---catatagcaccactgttatgatatagatagattagacaaagttacctggtggttctcgtaacaccataaagttatagtattttt |
30736772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University