View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5260_low_13 (Length: 240)
Name: NF5260_low_13
Description: NF5260
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5260_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 2222844 - 2223044
Alignment:
| Q |
20 |
taagaggaagttgtcaaatattatggatgatcctaataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattataga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222844 |
taagaggaagttgtcaaatattatggatgatcctaataatattgttgccgacaatattaataaatctaaagaaattgagcggcgttacgatgattataga |
2222943 |
T |
|
| Q |
120 |
aggaagagaaagcgtccatgcaaagtggcggtgggtcctacgatggaatcaaccaccggagaaaccgccaccacgtcacatggttttatatcggtgattg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2222944 |
aggaagagaaagcgtccatgcaaagtggcagtggttcctacgatggaatcaaccaccggagaaaccgccaccgcgtcacatggttttatatcggtgattg |
2223043 |
T |
|
| Q |
220 |
g |
220 |
Q |
| |
|
| |
|
|
| T |
2223044 |
g |
2223044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University