View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261-Insertion-5 (Length: 160)
Name: NF5261-Insertion-5
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261-Insertion-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 44014337 - 44014489
Alignment:
| Q |
8 |
agagtatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttggtttttgaaacggtgtaaaggat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44014337 |
agagtatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttggtttttgaaacggtgtaaaggat |
44014436 |
T |
|
| Q |
108 |
tatcagggaagaagattttagagagtctgtgtttgagtttgttgagtgatgtt |
160 |
Q |
| |
|
||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44014437 |
catcggggaagaagatttcagagagtctgtgtttgagtttgttgagtgatgtt |
44014489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 7 - 135
Target Start/End: Complemental strand, 3172867 - 3172739
Alignment:
| Q |
7 |
aagagtatactgagaaccccattgaaaaatggggaacaagaattgaagggtaagaagaaactttgtaaaagatggttggtttttgaaacggtgtaaagga |
106 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| || |||| | ||||||| | |||||||||||||| || || | |||||||||||| | || ||||| |
|
|
| T |
3172867 |
aagactatactgaggaccccattgaaaaatcggaaacatgtattgaagagccagaagaaactttgtgaaggaagtttggtttttgaatccatgaaaaggg |
3172768 |
T |
|
| Q |
107 |
ttatcagggaagaagattttagagagtct |
135 |
Q |
| |
|
| |||||| || ||||||| ||||||||| |
|
|
| T |
3172767 |
tcatcaggaaaaaagatttcagagagtct |
3172739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University