View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_high_12 (Length: 342)
Name: NF5261_high_12
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 1 - 325
Target Start/End: Complemental strand, 44461806 - 44461482
Alignment:
| Q |
1 |
tcatttccaggaatagaattatcgcaggtagtaatagcagccaaagcagccttcaaccatttctgactatcaacatcagattcaaccaacaaagcagcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461806 |
tcatttccaggaatagaattatcgcaggtagtaatagcagccaaagcagccttcaaccatttctgactatcaacatcagattcaaccaacaaagcagcaa |
44461707 |
T |
|
| Q |
101 |
tagtgtcttcaagttgagactcagcatccaatatattttctttgcaatcagccaaaccttgttgaacttcagggtctaaattagcatcatcaatcattga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461706 |
tagtgtcttcaagttgagactcagcatccaatatattttctttgcaatcagccaaaccttgttgaacttcagggtctaaattagcatcatcaatcattga |
44461607 |
T |
|
| Q |
201 |
tttcacgtcgtttaacattgcagaagcatttctagcagcaactcttagtgctataattgccaaatcattaatgtcgtctgcgtttgcggattttgggtcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44461606 |
tttcacgtcgtttaacattgcagaagcatttctagcagcaactcttagtgctataattgccaaatcattaatgtcgtctgcgtttgcggattttgggtcg |
44461507 |
T |
|
| Q |
301 |
gatgacagaacttcaacacagaggt |
325 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44461506 |
gatgacagaacttcaacacagaggt |
44461482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University