View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_high_19 (Length: 240)
Name: NF5261_high_19
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 13797345 - 13797127
Alignment:
| Q |
18 |
gttgtaagctgttttttctcataatcctaacttcttctctattgtgatttttgtgaacataagttacaaaacatggatttctaaagcttttataccgtga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13797345 |
gttgtaagctgttttttctcataatcctaacttcttctctattgtgatttttgtgaacataagttacaaaacatggatttctaaagcttttatacagtga |
13797246 |
T |
|
| Q |
118 |
ttatggtaaaaccaaatttaagttaaattttgtaaactgaattgaatttatgggttgctagctatgtactacatgcatcaccagcaagataggttttaaa |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13797245 |
tcttggtaaaaccaaatttaagttaaattttgtaaattgaattgaatttatgggttgctagctatgtactacatgcatcaccagcaagataggttttaaa |
13797146 |
T |
|
| Q |
218 |
acacggtctacaatcacga |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13797145 |
acacggtctacaatcacga |
13797127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University