View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_high_6 (Length: 429)
Name: NF5261_high_6
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 118 - 411
Target Start/End: Original strand, 34303608 - 34303901
Alignment:
| Q |
118 |
tactaattttgagtctaggctttgtaaaaattattctcatttgttgacatttttctttgcttgattgaattcaacatgaaggatgaaccaaaattgaaag |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34303608 |
tactaattttgagtctaggctttgtaaaaattattctaattttttgacatttttctttgcttgattgaattcaacatgaaggatgaaccaaaattgagag |
34303707 |
T |
|
| Q |
218 |
agacattgacatttgcaaatgcttgtggagcaatgtgtacaacacagaagggagccattcctgcacttccaactgctgaagaggctcagaaatttatttc |
317 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34303708 |
agacattgacatttgcaaatgcctgtggagcaatgtgtacaacacagaagggagccattcctgcacttccaactgctgaagaggctcagaaatttatttc |
34303807 |
T |
|
| Q |
318 |
cagctctaaagccaaataagaacttgcaaatgctttgaaatttgatgatggtccagaggactagctatattaattttcatttgagagatttttc |
411 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
34303808 |
cagctctaaagccaaataagaacttgcaaatgctttgaaatttgatgatggtccagaggactagctatattcattttcatttgagagttttttc |
34303901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 34303521 - 34303593
Alignment:
| Q |
7 |
attcttttgttggtgcacttctcagagatgtggcaagagacccttctatatttgaggtatactttctctctct |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
34303521 |
attcttttgttggtgcacttctcagagatgtggcaagagacacttctatatttgaggtatagtttctctctct |
34303593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University