View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_low_10 (Length: 407)
Name: NF5261_low_10
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 162 - 398
Target Start/End: Complemental strand, 1329669 - 1329433
Alignment:
| Q |
162 |
ggctggttcctctggtggtggaagggccttgacttcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329669 |
ggctggttcctctggtggtggaagggccttgactgcattcatatcctcttccggttcaggttcgggttcgggttccttggcttcttcatccgaattgttc |
1329570 |
T |
|
| Q |
262 |
tcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329569 |
tcttcttgaacatcagctttattgctttgtgctagcatgttcttatctttgataaactcttccataacctctaacttctttggtgtgaccttatctatct |
1329470 |
T |
|
| Q |
362 |
cagggtactcagaagagcgacaaattccaatattctt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329469 |
cagggtactcagaagagcgacaaattccaatattctt |
1329433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 1329830 - 1329719
Alignment:
| Q |
1 |
cttgttgctggtgcagccccatcaaataaagctaaggcaagtttgtccccatgttcttcagttgtcactctatcatctcctaagttcaacaaatcaccct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1329830 |
cttgttgctggtgcagccccatcaaataaagctaaggctagtttgtccccatgttcttcagttgtcactctatcatctcctaagttcaacaaatcaccct |
1329731 |
T |
|
| Q |
101 |
cggtttgcacaa |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
1329730 |
cggtttgcacaa |
1329719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University