View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_low_16 (Length: 315)
Name: NF5261_low_16
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 10 - 241
Target Start/End: Original strand, 23040845 - 23041076
Alignment:
| Q |
10 |
gcaaaggttccgttgtgcccaatgaaatcattgtcttatctcaaaagaagaattgaaattgatgaccttgtccatcnnnnnnnctgacaaataagaaagg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
23040845 |
gcaaaggttccgttgtgcccaatgaaatcattgtcttatctcaaaagaagaattgaaattgatgaccttgtccatcaaaaaaactgacaaaattgaaagg |
23040944 |
T |
|
| Q |
110 |
gacgagatagttttcaaacagactattttttatatccttagtttctacaatattattttgacatcatcataggctgtagttcaagccttcttatatttac |
209 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23040945 |
gacgagatagttttcaaaaagactattttttatatccttagtttctacaatattattttgacatcatcataggctgtagttcaagccttcttatatttac |
23041044 |
T |
|
| Q |
210 |
catacagccggccaaagaaacaaatgcatggc |
241 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |
|
|
| T |
23041045 |
cttacagccggccaaagaaacaaatgcatggc |
23041076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 16 - 60
Target Start/End: Original strand, 21781627 - 21781671
Alignment:
| Q |
16 |
gttccgttgtgcccaatgaaatcattgtcttatctcaaaagaaga |
60 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
21781627 |
gttcccttgtgttcaatgaaatcattgtcttatctgaaaagaaga |
21781671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University