View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_low_24 (Length: 216)
Name: NF5261_low_24
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 44561370 - 44561190
Alignment:
| Q |
20 |
tacaatgcatataatatgagcagaacaaaaaccgtgtgatttgaattcccttttgatttcgggatgtgaacaactgaacatgatttacattttccttgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44561370 |
tacaatgcatataatatgagcagaacaaaaaccgtgtgatttgaattcccttttgatttcgggatgtgaacaactgaacatgatttgcattttccttgct |
44561271 |
T |
|
| Q |
120 |
gaatgaatatcaaatgacaatacttgtttcttgtttggactcaaattacaaaacttcaatgaatacttgtgaattcttact |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44561270 |
gaatgaatatcaaatgacaatacttgtttcttgtttggactcaaattacaaaacttcaatgaatacttgtgaattcttact |
44561190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University