View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5261_low_8 (Length: 420)
Name: NF5261_low_8
Description: NF5261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5261_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 280; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 280; E-Value: 1e-156
Query Start/End: Original strand, 3 - 326
Target Start/End: Complemental strand, 39097774 - 39097460
Alignment:
| Q |
3 |
atcattcacccaattgtttgccagagtgctcatctttaagcaaagactcgtgtgaggaattattctttcactctattttgcatgcgtggcaggttgtggt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39097774 |
atcattcacccaattgtttgccagagtgctcatctttaagcaaagactcgtgtgaggaattattctttcactctattttgcatgcgtggcaggttgtggt |
39097675 |
T |
|
| Q |
103 |
ccttacaattattaaagggctctatcttttgtgtattttcatactcaacttagatgcacataagtaacaacatgttagataatcctcaaatcgctgttga |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39097674 |
ccttacaattattaaagggctctatcttttgtgtattttcatactcaacttagatgcacataagtaacaacatgttagataatcctcaaatcgctgttga |
39097575 |
T |
|
| Q |
203 |
aaaaagtgtaaaaggtgtcacgtttgatgagataacaatacttgaattaattttgtaaggatgatttatgtgtaacatgaaattttaaggttacatcaaa |
302 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
39097574 |
aaaaa---------gtgtcacgtttgatgagataacaatacttgaattaattttgtaaggatgagttatgtgtaacatgaaattttaaggttatatcaaa |
39097484 |
T |
|
| Q |
303 |
gtttatttaaaatgtgttggttta |
326 |
Q |
| |
|
||||||||||||||||||| |||| |
|
|
| T |
39097483 |
gtttatttaaaatgtgttgcttta |
39097460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University