View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5262-Insertion-4 (Length: 216)
Name: NF5262-Insertion-4
Description: NF5262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5262-Insertion-4 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 42028449 - 42028247
Alignment:
| Q |
13 |
gtgtgtaggtactaaagctaaccatatatgctcatgtctgtaaaacaactaaatttcaaaggaattagtatatgaataaacaagagttaatcatattaac |
112 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42028449 |
gtgtgtaggtagtaaagctaaccatatatgctcatatatgtaaaacaactaaatttcaaaggaattagtatatgaataaacaagagttaatcatattaac |
42028350 |
T |
|
| Q |
113 |
tcttttcttttctaaattcttttaaaagtgatcatgcgcagctcacattatgatgcttccgctatctttgcatgcccctatatccccactacagagttgc |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42028349 |
tcttttcttttctaatttcttttaaaagtgatcatgtgcagctcacattatgatgcttccactatctttgcatg-ccctatatccccactacagagttgc |
42028251 |
T |
|
| Q |
213 |
atgc |
216 |
Q |
| |
|
|||| |
|
|
| T |
42028250 |
atgc |
42028247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University