View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5262-Insertion-6 (Length: 129)
Name: NF5262-Insertion-6
Description: NF5262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5262-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 5e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 5e-31
Query Start/End: Original strand, 59 - 129
Target Start/End: Complemental strand, 10201393 - 10201323
Alignment:
| Q |
59 |
aattttaagttcatcttccatttcttgtggttcaattgttgtatggttgtttgtaaacattttctcttccc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10201393 |
aattttaagttcatcttccatttcttgtggttcaattgttgtatggttgtttgaaaacattttctcttccc |
10201323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.00000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.00000000006
Query Start/End: Original strand, 72 - 129
Target Start/End: Complemental strand, 51740585 - 51740528
Alignment:
| Q |
72 |
tcttccatttcttgtggttcaattgttgtatggttgtttgtaaacattttctcttccc |
129 |
Q |
| |
|
|||||||| |||||||||||||| | ||||||||| |||| |||||||||||||||| |
|
|
| T |
51740585 |
tcttccatctcttgtggttcaatagctgtatggttatttgagaacattttctcttccc |
51740528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University