View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5262_high_3 (Length: 526)
Name: NF5262_high_3
Description: NF5262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5262_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 490; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 490; E-Value: 0
Query Start/End: Original strand, 9 - 510
Target Start/End: Original strand, 54098050 - 54098551
Alignment:
| Q |
9 |
agcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggagaaacttctgctgcggtaagtaaatgcaaattgggt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54098050 |
agcagagaaaaggaaggcagaatatgagaaaaccatgaaggcatataacaagaaacaggtgggtgaaacttctgctgctgtaagtaaatgcaaattgggt |
54098149 |
T |
|
| Q |
109 |
aagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgcatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54098150 |
aagtaggtttttgatgatttatttgtgattgttgtcaggctgaaggtccagctgctgttgaggaagaagaatctgggaaatcagaatctgaagtgcatga |
54098249 |
T |
|
| Q |
209 |
tgagaatgaggatgatgatgaggatggcagtgaagaggtcagcacacatactttttcttttgttgaatttcactttgtaggaaagtctttgcatattgta |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
54098250 |
tgagaatgaggatgatgatgaggatggcagtgaagaggtcagcacacatactttttcttttgttgaatttcactttgtaggaaagtctttgcatatttta |
54098349 |
T |
|
| Q |
309 |
gttgttaatttgttccttatgtttcatgcaggaggaggatgacgagtagaaacttggatgatgataacatttatgtaggatgtgctgatgatttgatcat |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54098350 |
gttgttaatttgttccttatgtttcatgcaggaggaggatgacgagtagaaacttggatgatgataacatttatgtaggatgtgctgatgatttgatcat |
54098449 |
T |
|
| Q |
409 |
cttgtgtagatgatcttttcgtttcttgataaacatgtcttacttctaggaatattttgctgctcccttggtaaatgttttgtcttttcaaaacgtgaat |
508 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54098450 |
cttgtgtagatgatcttttcgtttcttgataaacatgtcttacttctaggaatattttgctgctcccttggtaaatgttttgtcttttcaaaacgtgaat |
54098549 |
T |
|
| Q |
509 |
ag |
510 |
Q |
| |
|
|| |
|
|
| T |
54098550 |
ag |
54098551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University