View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5262_low_20 (Length: 254)
Name: NF5262_low_20
Description: NF5262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5262_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 36774431 - 36774189
Alignment:
| Q |
15 |
tctaaacaaaactgtttttgagtttaataaa---ttagtggtgaacaaaagtgtgatagaacaaaatgcttccacttcaaccgaccaccatagttctttg |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774431 |
tctagacaaaactgtttttgagtttaataaaaaattaggggtgaacaaaagtgtgatagaacaaaatgcttccacttcaaccgaccaccatagttctttg |
36774332 |
T |
|
| Q |
112 |
aaatttccgtagttagcaacttcctctttgcttcccaactctagtcacacgcgaagacaaggtatcaggtttgaaatttctatgcaacttattcacagca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36774331 |
aaatttccgtagttagcaacttcctctttgcttcccaactctagtcacacgcgacgacaaggtatcaggtttgaaatttctatgcaacttattcacggca |
36774232 |
T |
|
| Q |
212 |
cttattagttaaactggtttatgtgaagtagtatatgatacat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36774231 |
cttattagttaaactggtttatgtgaagtagtatatgatacat |
36774189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University