View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5262_low_24 (Length: 225)
Name: NF5262_low_24
Description: NF5262
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5262_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 79 - 208
Target Start/End: Original strand, 35948548 - 35948677
Alignment:
| Q |
79 |
aagaattattacagtgttaattcgacatgtatggatacatctatctactatagacttgagaaaataaagggctagcgagaaaataaaggaatagcacaat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35948548 |
aagaattattacagtgttaattcgacatgtatagatacatctatctactatagacttgagaaaataaagggctagcgagaaaataaaggaatagcacaat |
35948647 |
T |
 |
| Q |
179 |
gacaaaaacatcctttccccctctaatttc |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
35948648 |
gacaaaaacatcatttccccctctaatttc |
35948677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 17 - 55
Target Start/End: Original strand, 35948481 - 35948519
Alignment:
| Q |
17 |
aagatgtgtttaaataacaactattttttagaattatta |
55 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35948481 |
aagatgtgtttaaataacaactatttttgagaattatta |
35948519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University