View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5263-Insertion-5 (Length: 73)
Name: NF5263-Insertion-5
Description: NF5263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5263-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 64; Significance: 1e-28; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 1e-28
Query Start/End: Original strand, 6 - 73
Target Start/End: Original strand, 13945237 - 13945304
Alignment:
| Q |
6 |
cacatttatcaccaccagaaaaatttatgacgattccacaaccacctctgtttgtattttcaccacct |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13945237 |
cacatttatcaccaccagaaaaatttatgacgattccacaaccacctctgtttgtattttcatcacct |
13945304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University