View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5263_high_12 (Length: 238)

Name: NF5263_high_12
Description: NF5263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5263_high_12
NF5263_high_12
[»] chr5 (1 HSPs)
chr5 (21-229)||(42330141-42330349)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 229
Target Start/End: Complemental strand, 42330349 - 42330141
Alignment:
21 tatggcgttattgacttgagagaggagtgtgaatagaatcttcaaaaagatatcaacagaaaaaatatacttgagaggctccatgcagcatatttctatc 120  Q
    ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42330349 tatggcgttattgacttgagagaggagtgtgaaaagaatcttcaagaagatatcaacagaaaaaatatacttgagaggctccatgcagcatatttctatc 42330250  T
121 aattgccctacttgaagattagttgcgctcaatatttagtggaatttggtaaaatacatgaaatctgggatgattttcttgccttcctaaaattggcaga 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42330249 aattgccctacttgaagattagttgcgctcaatatttagtggaatttggtaaaatacatgaaatctgggatgattttcttgccttcctaaaattggcaga 42330150  T
221 tgatgatgt 229  Q
    ||| |||||    
42330149 tgacgatgt 42330141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University