View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5263_high_8 (Length: 253)
Name: NF5263_high_8
Description: NF5263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5263_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 4082683 - 4082892
Alignment:
| Q |
18 |
gttacaactcttgatgaaatttttgtaggcttgtggtttgtcgaagcggcgaaccactgaccaaacggctgtgatggaggcagttgtctcttggacaacc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
4082683 |
gttacaactcttgatgaaatttttgtaggcttgtggtttgtcgaagcggcgaaccactgaccaaacggctgtgatggaggcggttgtctcttggacgacc |
4082782 |
T |
|
| Q |
118 |
gccgagcataattggtcggatgatatggagtgtgtgtgatagtgggctatagtgttaggaatggtgctggtcacagggttgatgaagagggtgttgtttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082783 |
gccgagcataattggtcggatgatatggagtgtgtgtgatagtgggctatagtgttaggaatggtgctggtcacagggttgatgaagagggtgttgtttt |
4082882 |
T |
|
| Q |
218 |
cgccgtggag |
227 |
Q |
| |
|
||| |||||| |
|
|
| T |
4082883 |
cgcagtggag |
4082892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University