View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5263_low_11 (Length: 238)
Name: NF5263_low_11
Description: NF5263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5263_low_11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 1920909 - 1920688
Alignment:
| Q |
17 |
agatcattgacaatatgttattgtatttgaaaagaagcaacctaatttcattttagttttatttcaacaaatattaaaaattaacaaaacccaccaatnn |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1920909 |
agatcattgacaatatgttattgtatttgaaaagaagcaacctaatttctttttagtttt-tttcaacaaatattaaaaattaacaaaacccaccaataa |
1920811 |
T |
 |
| Q |
117 |
nnnnnngaag---tccaaatacatgttgtttgttaagttgcttaattgcaatatgttaggatctgagatccacaaactctcttagaggtgtgtggatgac |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1920810 |
aaaaaagaagaagtccaaatacatgttgtttgttaagttgcttaattgcaatatgttaggatctgagatccacaatctctcttagagg--tgtggatgac |
1920713 |
T |
 |
| Q |
214 |
ttcgagtcgtcggtcttcaatcagt |
238 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
1920712 |
ttcgagtcgtcggtcttcaatcagt |
1920688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University