View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5263_low_12 (Length: 238)
Name: NF5263_low_12
Description: NF5263
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5263_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 229
Target Start/End: Complemental strand, 42330349 - 42330141
Alignment:
| Q |
21 |
tatggcgttattgacttgagagaggagtgtgaatagaatcttcaaaaagatatcaacagaaaaaatatacttgagaggctccatgcagcatatttctatc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42330349 |
tatggcgttattgacttgagagaggagtgtgaaaagaatcttcaagaagatatcaacagaaaaaatatacttgagaggctccatgcagcatatttctatc |
42330250 |
T |
 |
| Q |
121 |
aattgccctacttgaagattagttgcgctcaatatttagtggaatttggtaaaatacatgaaatctgggatgattttcttgccttcctaaaattggcaga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42330249 |
aattgccctacttgaagattagttgcgctcaatatttagtggaatttggtaaaatacatgaaatctgggatgattttcttgccttcctaaaattggcaga |
42330150 |
T |
 |
| Q |
221 |
tgatgatgt |
229 |
Q |
| |
|
||| ||||| |
|
|
| T |
42330149 |
tgacgatgt |
42330141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University