View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5264-Insertion-3 (Length: 196)
Name: NF5264-Insertion-3
Description: NF5264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5264-Insertion-3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 8 - 184
Target Start/End: Complemental strand, 5034942 - 5034765
Alignment:
| Q |
8 |
tattcgcaagtcatatattttcttgtagaacaaatagtggtattcaagtaagaattcgggtgcaactgttcacattaggcatccgcacaacattgaatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5034942 |
tattcgcaagtcatatattttcttgtagaacaaataatggtattcaagtaaggattcgggtgcaactgttcacattaggcatccgcacaacattgaatta |
5034843 |
T |
 |
| Q |
108 |
gatgacttgatttttatatagtgtgtggcagaactggaagg-aaatttactacttcagatgat-taaggatgttatatt |
184 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5034842 |
gatgacttgatttttatttagt-tttggcagaactggaaggaaaatttactacttcagatgatctaaggatgttatatt |
5034765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University