View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5264_high_10 (Length: 250)
Name: NF5264_high_10
Description: NF5264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5264_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 36504997 - 36505208
Alignment:
| Q |
1 |
catttccgaactcatttttgcagccattccgccccatttatgtagagcaagccttcttccatttcaaaagt--tatctataaatcctcattgccattccg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36504997 |
catttccgaactcatttttgcagccattccgccccatttatgttgagcaagccttcttccatttcaaaagttatatctataaatcctcattgccattccg |
36505096 |
T |
|
| Q |
99 |
ccccatttatgcg---------nnnnnnnncttctttttgcgatttagagtttcgtttatgcaattttatcatacttcatttggttgatcatgtattgga |
189 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36505097 |
ccccatttatgcgttttttttttcttttttcttctttttgcgatttagagttttgtttatgcaattttatcatacttcattttgttgatcatgtattgga |
36505196 |
T |
|
| Q |
190 |
tttcaagtagga |
201 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36505197 |
tttcaagtagga |
36505208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University