View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5264_high_8 (Length: 262)
Name: NF5264_high_8
Description: NF5264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5264_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 162 - 248
Target Start/End: Original strand, 6323184 - 6323270
Alignment:
| Q |
162 |
ttcacaaaattcaattctttttgtggagtgaattcagttcgatcatcactgttttcctcgcttgtgtttgtggcggcgatttgtctc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6323184 |
ttcacaaaattcaattctttttgtggagtgaattcagttcgatcatcactgttttcctcgcttgtgtttgtggcggcgatttgtctc |
6323270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 28126430 - 28126367
Alignment:
| Q |
1 |
tccctttgactccgtgattctcaacatggtatcagagtgatactcgagggaggaagatgaagat |
64 |
Q |
| |
|
||||| ||| ||| ||||| ||||||||||||||||| ||||| | |||||||||||||||||| |
|
|
| T |
28126430 |
tccctatgattccatgattttcaacatggtatcagagcgataccctagggaggaagatgaagat |
28126367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 5377093 - 5377156
Alignment:
| Q |
1 |
tccctttgactccgtgattctcaacatggtatcagagtgatactcgagggaggaagatgaagat |
64 |
Q |
| |
|
||||| ||| ||| ||||||| ||||||||||||||| ||||| | |||||||||||||||||| |
|
|
| T |
5377093 |
tccctatgattccatgattcttaacatggtatcagagcgataccctagggaggaagatgaagat |
5377156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 52518975 - 52519038
Alignment:
| Q |
1 |
tccctttgactccgtgattctcaacatggtatcagagtgatactcgagggaggaagatgaagat |
64 |
Q |
| |
|
||||| ||| ||| ||||| ||||||||||||||||| ||||| | |||||||||||||||||| |
|
|
| T |
52518975 |
tccctatgattccatgattttcaacatggtatcagagcgataccctagggaggaagatgaagat |
52519038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 6789835 - 6789894
Alignment:
| Q |
1 |
tccctttgactccgtgattctcaacatggtatcagagtgatactcgagggaggaagatga |
60 |
Q |
| |
|
||||| ||| ||| ||||||| ||||||||||||||| ||||| | |||||||||||||| |
|
|
| T |
6789835 |
tccctatgattccatgattcttaacatggtatcagagcgataccctagggaggaagatga |
6789894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 64
Target Start/End: Original strand, 17449525 - 17449588
Alignment:
| Q |
1 |
tccctttgactccgtgattctcaacatggtatcagagtgatactcgagggaggaagatgaagat |
64 |
Q |
| |
|
||||| ||| ||| ||||||| ||||||||||||||| ||||| | ||| |||||||||||||| |
|
|
| T |
17449525 |
tccctatgattccatgattcttaacatggtatcagagcgataccctaggaaggaagatgaagat |
17449588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 24 - 72
Target Start/End: Complemental strand, 31155525 - 31155477
Alignment:
| Q |
24 |
acatggtatcagagtgatactcgagggaggaagatgaagattgtgcttc |
72 |
Q |
| |
|
|||||||||||||| ||||| ||||||| | ||||||||| |||||||| |
|
|
| T |
31155525 |
acatggtatcagagcgatacccgagggatgtagatgaagactgtgcttc |
31155477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University