View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5264_low_14 (Length: 227)
Name: NF5264_low_14
Description: NF5264
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5264_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 11 - 51
Target Start/End: Original strand, 53700646 - 53700686
Alignment:
| Q |
11 |
catgtgttggggatcaaggatttctacaactagattttatg |
51 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700646 |
catgttttggggatcaaggatttctacaactagattttatg |
53700686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University